Best in class potential

Glaucoma treatment

original drug candidate

General information

Relevance

  • The global prevalence of glaucoma for a population aged 40 to 80 years is 3.54%.
  • The number of people with glaucoma worldwide will increase to 111.8 million by 2040.
  • Glaucoma is the main cause of blindness after cataracts.
  • 10% of people with glaucoma who receive proper treatment still experience vision loss.

Existence of analogues: By separate mechanisms of action, analogues are latanoprost, bimatoprost and travoprost. By the mechanism of neuroprotective action there are no analogues.

Serinoprost (SRP)

Therapeutic area: (S01EE - Analogs of prostaglandin).

Nosological classification (ICD-10):
H40.0 Suspicion of glaucoma
H40.1 Primary open-angle glaucoma

Innovative status: original individual molecule with the best in class potential

Planned dosage form: eye drops

Type of molecule: small hybrid molecule based on endogenous pharmacophores from the family of eicosanoids and amino acids; 20 new prostaglandin F2 alpha derivatives were selected from the library.

Hypotensive effect of SRP

Decrease in intraocular pressure, Mmhg. Normotensive model, rabbits, n = 10

The concentration of substances is 100 μg / ml, One drop in each eye

The experiments were conducted at the Helmholtz Research Institute of Eye Diseases
Serinoprost acts like an endogenous regulator, but surpasses it in maximum effect

Anti-ischemic action

Blood flow increase,% relative to control

Change in the minute volume of blood flow in the eye of a rabbits 30 minutes after the development of ischemia during SRP instillation

SRP has a protective effect on ischemia of the eye both before and after the development of ischemia

Mechanism of action

Biotarget. Interaction with the Prostanoid FP Receptor Functional response
Increased intracellular calcium concentration (excess over control values) in response to interaction with the FP receptor

Serinoprost acts similarly to endogenous prostaglandin F2 alpha and prostamide F2, but the response is more pronounced and is approximately equal to the sum of the effects of natural regulators. Ca2+ response, 67 μM, incubation 10 min.

Ca2+ response , concentration 67 μM, incubation time 10 min, control subtracted. *- significant difference between groups.

FP receptor expression in mouse 3T3-L1 cells

Primers for musFPR
CATGAAGGCCTACCAGAGATTTAGTTGATAAG

Anti-ischemic action

SRP provoked NO generation in 3T3-L1 cells

The increase in NO (nitrite),% relative to the control

Serinoprost induces nitric oxide production and increases the expression of the NO synthase gene in 3T3-L1 cells

Enhanced iNOS Gene Expression in 3T3-L1 Cells by SRP

INOS mRNA level relative to β-actin mRNA

Toxicity

Calculation of the expected toxicity of the compound for 15 targets
in the VirtualToxLab ver. 5.8

*the higher the value the safer
Mouse 3T3-L1 Cells
LC50 >> 100 μM

  1. Activation of the FP receptor (as in latanoprost and travoprost).
  2. Activation of a prostamide receptor (not yet precisely identified, as in bimatoprost).
  3. Activation of endogenous NO synthase, mobilization of endogenous calcium.

The activity resulting from the activation of mechanisms:

  • Reducing intraocular pressure through regulation of the outflow of intraocular fluid along the uveoscleral pathway and trabecular network.
  • Protective effect on retinal neurons due to anti-ischemic activity.

As part of the project, additional studies will be carried out to clarify the mechanism of action of the hybrid molecule.